FIELD: biotechnology.
SUBSTANCE: invention relates to the field of biotechnology. Invention is a set of synthetic oligonucleotides for detecting DNA of human papilloma virus of type 52 of high carcinogenic risk of Seq.N1 and Seq.N2 sequences, also using a probe with a fluorescent label, whose fluorescence intensity indicates the amount of product formed, Seq.N3: GGCTGCAGTGTGTGCAGTG Seq.N1, AAGCGTAGGCACATAATACACACG Seq.N2, TGGACAAGCAGAACAAGC Seq.N3.
EFFECT: invention widens the range of means of detecting human papilloma virus 52 of high-carcinogenic risk in biological material.
1 cl, 3 ex
Authors
Dates
2020-12-01—Published
2019-12-27—Filed