FIELD: biology.
SUBSTANCE: invention concerns molecular biology and can be applied in epidemiology. It claims a method of cystic echinococcosis agent identification involving extraction of DNA from ehinococcus larvocyst cells and polymerase chain reaction (PCR) using primers specific to mitochondrial gene CO1 of Echinococcus granulosus. Oligonucleotides with sequences 5' TGTGTTGATTTTGCCTGG 3' and 5' GCCACCACAAACCAAGTATC 3' are applied as direct and reverse primers respectively, as they are more universal in relation to various isolates of disease causative agents.
EFFECT: increased analysis reliability for population research in different regions.
2 ex
| Title | Year | Author | Number |
|---|---|---|---|
| METHOD FOR DIFFERENTIATION OF NATURE OF ORIGIN OF RECURRENT CYSTS DURING CYST ECHINOCOCCOSIS | 2015 |
|
RU2591807C1 |
| METHOD OF DETECTING PREDISPOSITION AND RESISTANCE TO DEVELOPMENT OF CYST ECHINOCOCCOSIS IN CHILDREN | 2008 |
|
RU2387383C1 |
| METHOD OF PREDICTION OF CYSTIC ECHINOCOCCOSIS COURSE IN CHILDREN | 2007 |
|
RU2324940C1 |
| METHOD FOR PREDICTION OF SUPPURATION OF UNICAMERAL ECHINOCOCCUS CYST IN NONINVASIVE CHILDREN | 2007 |
|
RU2348039C1 |
| METHOD OF PREDICTING COMBINED AFFECTION OF ORGANS BY CYSTIC ECHINOCOCCOSIS IN CHILDREN | 2006 |
|
RU2307349C1 |
| METHOD FOR PREDICTION OF EFFECTIVENESS OF PREVENTION BY ALBENDAZOLE OF POSTOPERATIVE RECURRENT OF CISTIC ECHINOCOCCOSIS | 2015 |
|
RU2601902C1 |
| METHOD FOR PREDICTING ECHINOCOCCOSIS RECURRENCE | 2006 |
|
RU2313275C1 |
| METHOD OF TREATMENT LARVAL ECHINOCOCCOSIS OF LABORATORY ANIMALS | 2013 |
|
RU2517044C1 |
| fr316 FRAGMENT OF MITOCHONDRIAL GENE ND1 INTENDED FOR OPISTORCHOSIS AGENTS DETECTION | 2006 |
|
RU2332456C1 |
| METHOD FOR ACTIVATION OF CESTODE ONCOSPHERES FOR LABORATORY DEVELOPMENTS OF ANTIGEN | 2020 |
|
RU2725248C1 |
Authors
Dates
2008-08-27—Published
2006-12-18—Filed