FIELD: medicine.
SUBSTANCE: technique involves the stages of immobilising an antigen into the wells of a polystyrene 96-well plate, binding the antigen to a biotylated antigen, conducting a reaction of the biotylated antigen and a streptavidin complex (a complex of streptavidin - biotin - DNA target), conducting a real-time polymerase chain reaction using a fluorescent probe. What is used is the DNA target with a sequence: ACCAOCTCCCCACCACTOCCAACCACCTCOCOTA GGATAGAGTCAGTCCTTGGCCTCCTTGGCCCAGTTAAGAAGTTGCAGCC ACACACGCTGTTGTTGGGTTCGGGGCGGAGTTGCAGCCATCTACACAA ACGATACCCTCGTGCAGCTGGAGAAGCAGCACGGCCTATTACCTGGAG GAGGATCGAAACTGA, and the monoclonal antibody 15B3. The antibody reacts with a pathogenic prion protein, but not with a normal one, and detects PrPSc in homogenates of the infected material without the need of action of proteinases. The technique enables simplifying the real-time immuno-PCR method and increasing its sensitivity by immobilising the antigen on a plate substrate with using no capture antibodies, as well as using the DNA target having no homology with the GenBank database sequences.
EFFECT: reducing a risk of false responses as a result of exogenous contamination.
6 tbl, 2 ex
Authors
Dates
2013-06-27—Published
2012-02-27—Filed