FIELD: biotechnologies.
SUBSTANCE: series of inventions relates to biotechnology. Method of simultaneous genodiagnostic of two mutant alleles, causing CVM and BLAD in cattle, involves DNA recovery from biological material polymerase chain reaction in real time using the reaction mixture (test system) with CVM/BLAD, containing 50 mMKCl, 50 mMTRIS-HCl, 250 nMdNTP, 2.5 mMMgCl2, primers - in the concentration of 200 nm, allele-specific probes in concentration of 100 Nm, having the following sequence: CVM_up - gattctcaagagcttaattctaagga, CVM_low - aagtaaaccccagcaaagccac, CVM_Wt - (FAM) aggtctcatggcagttct-(BHQ1), CVM_m - (R6G) catggcatttctcacagcat-(BHQ2), BLAD_up - ttaggcagttgcgttc, BLAD_low - acgttgacgaggtcatccacca, BLAD_Wt - (ROX) accccatcgacctgtacta-(BHQ1), BLAD_m (Cy5) ccatcggcctgtactacct-(BHQ2), diluent, 2.5 units. Taq DNA polymerase, three positive and one negative control sample. During preparation for conducting reaction required volume of components is calculated, based on the number of analyzed samples plus 4, reagents are mixed, then 20 mcl of the prepared PCR mixtures are added to test tubes prepared for PCR, 5 mcl of the control and analyzed samples are added into each PCR test tube, test tubes are placed into amplifier, primers annealing takes place at the stage of cycling at 64 °C for 30 s at number of cycles amplification equal to 40. Derived data is carried out by comparing the amplified genome sections, results are interpreted based on the presence or absence of intersection of fluorescence curve with threshold line installed at appropriate level.
EFFECT: invention enables diagnosing two mutant alleles simultaneously, causing CVM and BLAD in cattle, reduces time for RT PCR performing.
2 cl, 3 dwg, 4 tbl
