FIELD: biotechnology.
SUBSTANCE: invention relates to biotechnology can be used in medicine, veterinary medicine and clinical laboratory diagnostics. Disclosed is a kit for detecting leptospirosis in biological material through real-time polymerase chain reaction (RT-PCR). The kit contains synthetic oligonucleotides: 16SleptoN2F 5' - ATGTGATGATGGTACCTGCCT - 3', 16SleptoN2R 5' - ACGCTTGCACCATACGTATTA - 3'; as well as a fluorescent probe 16SleptoN2Pr 5' - HEX - TAACTACGTGCCAGCAGCC - BHQ - 3'.
EFFECT: invention enables effective detection of DNA of leptospira pathogenic species and intermediate groups due to high specificity.
1 cl, 5 tbl, 2 ex, 7 dwg
