FIELD: biotechnology; molecular genetics.
SUBSTANCE: method for detecting single nucleotide polymorphism of the PRL-RsaI locus using a test system has been proposed. The test system includes a mixture of deoxynucleotide triphosphates, a buffer for setting up the reaction, a thermostable enzyme - Taq polymerase, two synthetic oligonucleotide primers specific to a given DNA region: PRL-f CCTTATGAGCTTGATTCTTGGGTTGCTG; PRL-r ATATCATCTCCATGCCTTCCAGAAGTCG, two types of allele-specific fluorescent probes: PRLa - CGAGGTACGGGGTATG - FAM; PRLg - CGAGGTGCGGGGTATG - VIC, quenching probe common for both alleles: PRLbhq - (BHQ1) AAAGGAGCCCCAGATGCTAT - P, mineral oil that protects the reaction mixture from evaporation during PCR.
EFFECT: stable reproducibility of results when analyzing the number of DNA copies exceeding the sensitivity threshold of the test system.
1 cl, 1 dwg
| Title | Year | Author | Number |
|---|---|---|---|
| METHOD FOR DETERMINING POLYMORPHISM OF GENETIC MARKERS OF DAIRY PRODUCTIVITY OF CATTLE | 2022 |
|
RU2782833C1 |
| METHOD FOR CATTLE GENOTYPING BY 1401G/T ALLELES lhcgr (ss52050737) GENE BY PCR IN REAL TIME | 2019 |
|
RU2716116C1 |
| METHOD FOR REAL-TIME PCR FOR CATTLE GENOTYPING BY ALLELES 337C/G OF FSHR (RS43745234) GENE | 2019 |
|
RU2708559C1 |
| METHOD FOR CATTLE GENOTYPING BY BETA-LACTOGLOBULIN A AND B ALLELES (RS109625649 POLYMORPHISM) BASED ON PCR WITH ALLELE-SPECIFIC PROBES | 2021 |
|
RU2767996C1 |
| METHOD FOR DETERMINING PRODUCTIVITY OF COWS OF CATTLE BY POLYMORPHISM IN LEP GENE | 2019 |
|
RU2734964C1 |
| METHOD FOR DETECTING GENETIC POTENTIAL BY MILK QUALITY IN CATTLE | 2006 |
|
RU2317704C1 |
| METHOD FOR CATTLE GENOTYPING BY ALLELES 878 OF SCD1 (RS41255693) GENE BY PCR IN REAL TIME | 2020 |
|
RU2744174C1 |
| METHOD FOR PCR WITH ALLELE-SPECIFIC PROBES FOR GENOTYPING CATTLE BY ALLELES A AND B OF THE KAPPA-CASEIN GENE | 2021 |
|
RU2791519C1 |
| METHOD FOR CARRYING OUT PCR WITH ALLELE-SPECIFIC PROBES FOR GENOTYPING CATTLE BY THE ALLELES A AND K OF THE DGAT1 GENE | 2018 |
|
RU2662972C1 |
| METHOD FOR DIAGNOSIS OF CATTLE LEUKEMIA VIRUS | 2018 |
|
RU2694966C1 |
Authors
Dates
2023-11-16—Published
2022-10-28—Filed