FIELD: veterinary microbiology.
SUBSTANCE: test system for detecting the DNA of the causative agent of bovine moraxellosis (Moraxella bovis) in animal biological material using real-time polymerase chain reaction is described. The test system includes a buffer for carrying out a polymerase chain reaction, a mixture for carrying it out, consisting of deoxynucleoside triphosphates, oligonucleotide primers and fluorescent probes specific for a region of the animal's genome and for an internal control sample; a mixture of enzymes from DNA polymerase with antibodies that inhibit enzyme activity, TAQ POLYMERASE, an internal control sample in the form of a suspension of bacteriophage T4 with a concentration of 5×103 phage particles per 1 mcl, negative control sample, which is a mixture of recombinant plasmid DNA containing a fragment of the animal genome and a fragment of the T4 bacteriophage genome with the following nucleotide sequence: T4F: 5` - TACATATAAATCACGCAAAGC -3` - is a direct primer, T4R: 5` - TAGTATGGCTAATCTTATTGG-3` - is a reverse primer, T4P: CY5-5` - ACATTGGCACTGACCGAGTTC -3`-BHQ1 - is a probe, taken in a volumetric ratio of 1:1. Moreover, according to the invention, a fragment of the genome of the causative agent of pasteurellosis (Pasteurella multocida) with the following nucleotide sequence is used for a positive control sample: (5`-3`): Pm-F AACGTCCAATCAGTTGCGCC; Pm-R AGTGGGCTTGTCGGTAGTC; Pm-P R6G-CTCAACACACCAAACTCTGCCCAAC – BHQ1; T4-F TACATATAAATCACGCAAACG; T4-R TAGTATGGCTAATCTTATTGG; T4-P FAM-CATTGGCACTGACCGAGTTC-BHQ1 for the DNA of the causative agent of pasteurellosis (Pasteurella multocida), a fluorescent dye — ROX/Orange — was used.
EFFECT: expanding functionality and increasing accuracy in identifying the causative agent of pasteurellosis (Pasteurella multocida).
1 cl, 4 tbl, 1 ex
| Title | Year | Author | Number |
|---|---|---|---|
| METHOD FOR DETECTING DNA OF PASTEURELLA MULTOCIDA AGENT IN BIOLOGICAL MATERIAL OF ANIMALS AND FODDERS USING POLYMERASE CHAIN REACTION IN REAL TIME | 2023 |
|
RU2820832C1 |
| TEST SYSTEM FOR DETECTING DNA OF CAUSATIVE AGENT OF MANNHEIMIOSIS (MANNHEIMIA HAEMOLYTICA) IN BIOLOGICAL MATERIAL OF ANIMALS AND FODDERS USING REAL-TIME POLYMERASE CHAIN REACTION | 2023 |
|
RU2814548C1 |
| METHOD FOR DETECTION OF DNA OF NODULAR DERMATITIS VIRUS (LSDV) IN ANIMAL BIOLOGICAL MATERIAL BY MEANS OF POLYMERASE CHAIN REACTION IN REAL TIME | 2019 |
|
RU2719719C1 |
| TEST SYSTEM FOR DETECTING DNA OF LUMPY SKIN DISEASE VIRUS (LSDV) IN BIOLOGICAL MATERIAL OF ANIMALS USING A POLYMERASE CHAIN REACTION IN REAL TIME | 2019 |
|
RU2726242C1 |
| METHOD FOR DETECTION OF BOVINE LEUKOSIS VIRUS (BLV) PROVIRUS DNA IN FOOD BY REAL-TIME POLYMERASE CHAIN REACTION | 2022 |
|
RU2794654C1 |
| TEST SYSTEM FOR IDENTIFICATION OF MUTTON AND BEEF SPECIES IDENTITY IN FOOD RAW MATERIAL, FODDER AND FOOD PRODUCTS | 2018 |
|
RU2702858C1 |
| METHOD FOR DETECTING A NEW TYPE CORONAVIRUS INFECTION AGENT GENOME (NCOV19) IN PRIMATES | 2020 |
|
RU2740097C1 |
| TEST SYSTEM FOR THE DETECTION OF BOVINE LEUKOSIS VIRUS (BLV) DNA IN FOOD BY REAL-TIME POLYMERASE CHAIN REACTION | 2022 |
|
RU2782573C1 |
| METHOD FOR IDENTIFICATION OF SPECIES IDENTITY OF MUTTON AND BEEF IN FOOD RAW MATERIALS, FODDER AND FOOD PRODUCTS | 2018 |
|
RU2694713C1 |
| TEST SYSTEM FOR DETECTING DNA OF CAUSATIVE AGENT OF MORAXELLOSIS KPC (MORAXELLA BOVIS) IN BIOLOGICAL MATERIAL OF ANIMALS AND FEED USING POLYMERASE CHAIN REACTION IN REAL TIME | 2023 |
|
RU2819044C1 |
Authors
Dates
2024-03-01—Published
2023-06-08—Filed