METHOD FOR DETECTING A NEW TYPE CORONAVIRUS INFECTION AGENT GENOME (NCOV19) IN PRIMATES Russian patent published in 2021 - IPC C12Q1/68 

FIELD: veterinary virology.

SUBSTANCE: described is a method for detecting a genome of an agent of a new type of coronavirus infection (nCoV19). Method involves RNA extraction from biological material by choice: nasal, throat, nasopharyngeal swabs, nasopharyngeal aspirates, nasal washouts, sputum, bronchoalveolar lavage, sectional material, culture fluid samples, faecal extracts, fragments of abdominal organs taken from animals infected with coronavirus infection agent by sorption method. Further, cDNA synthesis on the RNA matrix by setup of single-step with the addition of internal and positive controls samples of the multiplex reverse transcription reaction and polymerase chain reaction – with 45 amplification cycles with real-time detection using oligonucleotide primers specific for the viral pathogen genome region, fluorescently labeled probe and control samples: an internal control sample in the form of a bacteriophage MS2 suspension with concentration of 5×10³ copies of nucleotide sequences per 1 mcl and a positive control sample in the form of a mixture of recombinant plasmid DNA containing a fragment of the coronavirus infection pathogen genome and a fragment of the bacteriophage MS2 genome taken in ratio 1:1. Then measuring the accumulation of the fluorescent signal through the channel for the specific signal and the Cy5/Red channel for the internal control signal and interpreting the results based on the presence or absence of the intersection of the fluorescence curve with the threshold line – Threshold, if the curves of the fluorescent signal accumulation go out before 35th cycle, then the reaction result is considered to be positive, and if curves do not cross threshold line or cross it after 35 cycle, result of reaction is negative. According to the invention, the biological material is taken from primates infected with a novel coronavirus infection agent nCoV19, and for the positive control sample, a mixture of recombinant plasmid DNA containing a fragment of the genome of the coronavirus infection agent of the new type nCoV19 and a fragment of the bacteriophage MS2 genome with the following nucleotide sequences: nCoV19-F 5'- GGAACTTCTCCTGCTAGA -3' – forward primer; nCoV19-R 5' – GCTGGTTCAATCTGTCAA -3' – reverse primer; nCoV19-P 5' -ROX- AAGCAAGAGCAGCATCACCGC -3' -BHQ2 – probe; MS2F, 5'-TGGCACTACCCCTCTCCGTATTCAC-3' – forward primer; MS2R, 5'-GTACGGGCGACCCCACGATGAC-3' – reverse primer; MS2P, Cy5 5'-CACATCGATAGATCAAGGTGCCTACAAGC-3'-BHQ2- probe. For a specific signal, the accumulation of the fluorescent signal is measured through a ROX/Orange channel. Invention extends the range of means of diagnosing coronavirus infection in primates, both in practice of veterinary service, and for scientific research.

EFFECT: invention extends functional capabilities and provides reliable diagnosis of new-type coronavirus infection (nCov19) in primates, in a method for detecting a genome of a coronavirus infection agent of a new type (nCov19) in primates.

1 cl, 4 tbl, 1 ex