FIELD: biotechnology, gene engineering, medicine.
SUBSTANCE: it has been elaborated the set of primers for reliable indication of genetic material of measles virus by taking into account the variations of genome structure of all known geographic viral isolates, in the territory of different Russian regions, as well. The set of oligonucleotide primers for identifying measles virus RNA contains 2 pairs of oligonucleotides that possess the activity of direct and reverse primers in reaction of reverse transcription and polymerase chain reaction (PCR) that have got the following structure: RF1:5'CGT(C,T)CTTAC(G,C)GCCCGCCCCG3'(20 n); RR2:5'GCGAGGCGCACGGGGACAGG3' (20 n); RF3:5'CCC(C,A)GAACTGGTGAGCCCCATGGG3' (24 n); RR4:5'CGCACCCCGG(C,T)GCAGTGC3' (18 n). The innovation enables to detect genetic material of measles virus in clinical samples.
EFFECT: higher reliable indication of genetic material of measles.
cl, 2 dwg, 6 ex, 2 tbl
Authors
Dates
2008-02-20—Published
2006-02-01—Filed