FIELD: medicine.
SUBSTANCE: invention refers to veterinary virology. What is described is a method for recognizing genome RNA of the Ibaraki disease virus (IDV) by the real-time PCR with detecting amplification products by using oligonucleotide primers and a probe complementary to segment 10 of the IDV genome coding non-structural proteins NS3 and NS3a. The method is implemented by using the real-time PCR under the following temperature conditions: 1) 5 min of cDNA pre-denaturation at 94°C; 2) 5 reaction cycles (denaturation at 94°C for 15 sec, primer annealing at 62°C for 15 sec, elongation at 72°C for 15 sec); 3) 35 reaction cycles with detecting at the stage of primer annealing (denaturation at 94°C for 15 sec, primer annealing at 62°C for 15 sec, elongation at 72°C for 20 sec). The reaction results are taken into account by analysing fluorescent signal accumulation curves for each test. What is presented is a nucleotide composition of the following primers and probe: IbarF 5'-GATCAAACCATTTTGCGCTT-3' IbarR5'-CTCATCCTCACCGCCTCATTG-3' IbarZ 5'-[HEX] TCTTGTATGGTCAATCCGCTGGCT [BH2J-3'.
EFFECT: invention enables reducing the test time, as well as conducting both quantitative, and qualitative analysis of the NC content in samples.
3 cl, 4 tbl, 6 ex
