FIELD: biotechnology.
SUBSTANCE: invention relates to biotechnology, in particular to molecular diagnostics. There are developed oligonucleotide primers and fluorescent-labeled probes for differentiation of genome of vaccine strain and field isolate of virus of infectious nodular dermatitis of cattle with additional detection of genome of capripox viruses by means of polymerase chain reaction in real time mode: field isolate of IND of cattle: f- 5'- TAGAAAATGGATGTACCACAAATACAG 3', r 5' -TTGTTACAACTCAAATCGTTAGGTG-3', probe 5' -ACCACCTAATGATAGTGTTTATGATTTACC-3; Capripox viruses: f - 5' ATGAAACCAATGGATGGGATA 3', r - 5' CGAAATGAAAAACGGTATATGGA 3', probe - 5' ATGAGCCATCCATTTTCCAA 3'4; vaccine strain of IND of cattle: f- 5'-TGTTTCCATTCTCCACTGCT-3', r - 5' -TACTTACTAAAAAATGGGCGCA-3', probe 5'-TCGCTGACATCGTTAGTCCACTC-3'. Disclosed is a method for differentiating the genome of a vaccine strain and a field isolate of the virus of infectious dermatoderma (nodular dermatitis) of cattle with additional detection of the genome of capripox viruses using real-time PCR at the same thermal profile using these primers and probes, and a PCR test system in real time for conducting thereof. A high-sensitivity PCR kit consisting of a ready PCR mixture, a Taq-polymerase enzyme, positive control and negative control, enabling specific detection and differentiation of the genome in the shortest possible time is developed.
EFFECT: disclosed are oligonucleotide primers and fluorescence-labeled probes, a method and a test system for differentiating the genome of the vaccine strain and the field isolate of the viral infectious dermatitis cattle with additional detection of the genome of capripox viruses using a real-time polymerase chain reaction.
3 cl, 3 dwg, 2 tbl, 3 ex
| Title | Year | Author | Number |
|---|---|---|---|
| OLIGONUCLEOTIDE PRIMERS AND A FLUORESCENT-LABELED PROBE, A METHOD AND A TEST SYSTEM FOR DETECTING GENOME OF VIRUS OF INFECTIVE NODULAR DERMATITIS (NODULAR DERMATITIS) OF CATTLE IN REAL-TIME POLYMERASE CHAIN REACTION | 2019 |
|
RU2714045C1 |
| OLIGONUCLEOTIDE PRIMERS AND FLUORESCENTLY MARKED PROBE, METHOD AND TEST SYSTEM FOR THE IDENTIFICATION OF THE GENOM OF FIELD ISOLATES OF LUMPY SKIN DISEASE VIRUS IN CATTLE IN THE REALIZATION OF POLYMERASE CHAIN REACTION IN THE REAL TIME MODE | 2017 |
|
RU2668398C1 |
| OLIGONUCLEOTIDE PRIMERS AND FLUORESCENCE-LABELLED PROBE, METHOD AND TEST SYSTEM OF PCR IN REAL TIME FOR DETECTING CAPRIPOXVIRUSES GENOME | 2017 |
|
RU2658493C1 |
| TEST SYSTEM FOR DETECTION OF SHEEPPOX VIRUS GENOME BY REAL-TIME POLYMERASE CHAIN REACTION | 2020 |
|
RU2744092C1 |
| TEST SYSTEM FOR DETECTING DNA OF LUMPY SKIN DISEASE VIRUS (LSDV) IN BIOLOGICAL MATERIAL OF ANIMALS USING A POLYMERASE CHAIN REACTION IN REAL TIME | 2019 |
|
RU2726242C1 |
| TEST SYSTEM FOR DETERMINING DNA OF NODULAR DERMATITIS VIRUS (LSDV) IN BIOLOGICAL MATERIAL OF ANIMALS BY PCR WITH ELECTROPHORETIC DETECTION OF AMPLIFICATION PRODUCTS IN AGAROSE GEL | 2019 |
|
RU2726432C1 |
| METHOD FOR DETECTION OF DNA OF NODULAR DERMATITIS VIRUS (LSDV) IN ANIMAL BIOLOGICAL MATERIAL BY MEANS OF POLYMERASE CHAIN REACTION IN REAL TIME | 2019 |
|
RU2719719C1 |
| METHOD OF INFECTIOUS BOVINE LUMPY SKIN DISEASE VIRUS GENOME EDITING USING OVERLAP-PCR AND CRISPR-CAS9 TECHNOLOGY | 2023 |
|
RU2825451C1 |
| METHOD FOR DETERMINING DNA OF NODULAR DERMATITIS VIRUS (LSDV) IN BIOLOGICAL MATERIAL OF ANIMALS BY PCR WITH ELECTROPHORETIC DETECTION OF AMPLIFICATION PRODUCTS IN AGAROSE GEL | 2019 |
|
RU2728660C1 |
| LUMPY SKIN DISEASE VIRUS OF THE CAPRIPOXVIRUS GENUS NEETHLING-ARRIAH STRAIN FOR THE MANUFACTURE OF BIOLOGICAL PRODUCTS FOR THE SPECIFIC PREVENTION OF INFECTIOUS NODULAR DERMATITIS IN CATTLE | 2023 |
|
RU2799604C1 |
Authors
Dates
2019-09-03—Published
2018-05-21—Filed