FIELD: biotechnology.
SUBSTANCE: method involves DNA isolation from pre-collected biological material, subsequent PCR of the mitochondrial DNA cytochrome oxidase region, amplicon restriction analysis, and agarose gel electrophoresis. During PCR, primers are used: direct ITS1 GAATATGAGCCGGAATAGTAGGA, reverse ITS4 ATGTGTTGAAGTTACGGTCA, and restriction enzymes AccB1 I, AspLE, Ssp I are used for restriction analysis; the presence of DNA fragments of 509 and 129 bp in length when treated with restriction enzyme AccB1 I indicates belonging to the A. cucumeris species, the presence of DNA fragments of 381 and 260 bp in length when treated with restriction enzyme Ssp I indicates belonging to the A. barkeri species, and the presence of 405 and 227 bp DNA fragments when treated with restriction enzyme AspLE indicates belonging to the A. swirskii species, while the other two restriction enzymes do not have restriction sites.
EFFECT: arsenal of methods for differentiation of commercially significant mites by restriction analysis is expanded.
2 dwg, 1 ex
