FIELD: biochemistry.
SUBSTANCE: invention relates to biochemistry. Method for differentiating the breeds of honey bees in Russia on the basis of mutagenic PCR-RFLP is described. Invention can be used to identify bee breeds in beekeeping enterprises and apiaries. Method of differentiating the key breeds of honey bees in Russia based on restriction analysis involves the extraction of DNA from pre-collected biological material by PCR-RFLP of the cytochrome oxidase region of the mitochondrial DNA subunit 1, and an amplicon restriction analysis, using mutagenic primers SRg1-r, SRg2-f, K/KR-r and KA-f, which together with subsequent processing of the PCR product by restriction enzymes Alu I, Hinf I, HspA I, Msp I form unique by length fragments for each breed of bees. SRg1-f GGATGAACAGTATATCCACC; SRg1-r GTAACTATTAAGTTTAATGATCCTATAATAGC; SRg2-f CTTTAATACTAGGATCACCTGATATAGCGAT; SRg2-r CTGATAATGGTGGATATA; K/KR-f AGATATTGGGATCTTGTA; K/KR-r CTAGTAACAATTGTATTATAAATTTGATCAGCG; KA-f ATTTCMTCAATTATAGGATCATTAAAYTTACC; KA-r CAGCTAATACAGGTAATGA.
EFFECT: technical result consists in differentiation of the breeds of bees at any stage of development, regardless of sex, as well as the possibility of conducting identification procedures without involving a highly specialized specialist within a few hours.
1 cl, 2 dwg, 1 ex
| Title | Year | Author | Number |
|---|---|---|---|
| DIAGNOSTIC METHOD OF PREDISPOSITION TO BREAST CANCER IN RUSSIAN POPULATION BASED ON PCR-RFLP | 2018 |
|
RU2723585C2 |
| METHOD FOR DIFFERENTIATION OF COMMERCIALLY IMPORTANT MITES OF AMBLYSEIUS GENUS BASED ON RESTRICTIVE ANALYSIS | 2016 |
|
RU2631933C1 |
| METHOD OF DETECTING GENETIC PREDISPOSITION TO VIRAL INFECTIONS | 2007 |
|
RU2352640C1 |
| METHOD FOR IDENTIFYING IMPORTANT FOR AGRICULTURE FUNGI OF THE GENUS TRICHODERMA-TRICHODERMA HARZIANUM, TRICHODERMA VIRIDE AND TRICHODERMA ATROVIRIDE BASED ON PCR-RFLP | 2023 |
|
RU2822738C1 |
| METHOD OF IDENTIFICATION OF SPECIES OF PREDATORY MITES OF AMBLYSEIUS GENUS | 2023 |
|
RU2804853C1 |
| METHOD FOR IDENTIFICATION OF SIGNIFICANT FOR AGRICULTURE REPRESENTATIVES OF GENUS BACILLUS-BACILLUS SUBTILIS, BACILLUS MEGATERIUM AND BACILLUS THURINGIENSIS BASED ON RESTRICTION ANALYSIS OF GENE 165S RRNA | 2023 |
|
RU2822737C1 |
| METHOD FOR CARRYING OUT PCR WITH ALLELE-SPECIFIC PROBES FOR GENOTYPING CATTLE BY THE ALLELES A AND K OF THE DGAT1 GENE | 2018 |
|
RU2662972C1 |
| METHOD FOR DETECTING VIRUS IRT KRS IN POLYMERASE CHAIN REACTION AND FOLLOWING DIFFERENTIATION OF VACCINE STRAIN TK-A FROM EPIZOOTIC STRAINS AND ISOLATES BY PLRF-ANALYSIS | 2003 |
|
RU2265667C2 |
| METHOD OF DETECTION AND DIFFERENTIATION OF ENTEROVIRUS RNA | 2000 |
|
RU2189396C2 |
| METHOD FOR DETERMINING POLYMORPHISM OF HSP70.1 GENE, WHICH CAUSES HEAT STRESS IN CATTLE | 2023 |
|
RU2826316C1 |
Authors
Dates
2018-05-08—Published
2017-06-20—Filed