METHOD OF DETECTION OF DELETION IN DAT RAT LINE Russian patent published in 2024 - IPC C12Q1/6827 

FIELD: molecular biology.

SUBSTANCE: invention can be used to detect mutation carriers in the DAT (knockout) rat line, in which the gene encoding the dopamine transporter from the family of sodium chloride-dependent neurotransmitters is switched off artificially. The following is proposed: a simple method of identifying a mutation in the form of a 5 bp deletion in the Slc6a3 gene in the DAT rat line by performing PCR using primers F - TCAAGGAGCAGAACGGAGTG and R - ACAGCAAAGCCGATGACTGA in the presence of Eva Green dye, followed by analysis of temperature dissociation curves of the resulting amplifiers and/or carrying out vertical electrophoretic separation of amplification products under non-denaturing conditions.

EFFECT: invention offers an effective, fast and reliable method of analyzing deletion in the DAT rat line for its presence/absence.

1 cl, 3 dwg, 1 tbl, 1 ex