FIELD: medicine.
SUBSTANCE: invention refers to biotechnology and concerns the cell strain CHO-IL7/13. The characterised strain is produced by transfection of the cells CHOdhfr by pIPvES-DHFR/IL7 plasmid containing human interleukin-7 gene. pIPvES-DHFR/IL7 plasmid has been synthesised by primer amplification of human interleukin-7 complementary DNA: ecoIL CCTGAATTCCACCATGTTCCATGTTTCTTTTAG containing EcoRI restriction site and Kozak sequence, and bamIL CCAGGATCCTCAGTGTTCTTTAGTGCCCATC containing BamHI restriction site that is followed by cloning according to the restriction site data into pIRES-DHFR vector.
EFFECT: presented strain has a higher producing ability of human recombinant interleukin-7 and can be used for treating the number of pathological conditions associated with the low content of B- and T-lymphocytes.
4 dwg, 3 ex
Authors
Dates
2015-09-10—Published
2012-10-29—Filed