METHOD OF PRODUCING BIOLOGICALLY ACTIVE PEPTIDES Russian patent published in 2016 - IPC C12P21/00 

FIELD: biotechnology.

SUBSTANCE: invention relates to biotechnology, namely to method of producing recombinant biologically active peptide, based on peptides in mielopid. Disclosed method involves transfection of cells Escherichia coli BL21 (DE3) with plasmid DNA pET30a, carrying gene with sequence ATGGGTCGTGGCTTCTTAGGCTTTCCAACTGGCCGTGGTCTGGTGGTGTATCCATGGGGTCGTGGTCTGGTGTGCTATCCGCAAGGTCGTGGCTTCCGTCCACGCATCATGACTCCAGGCCGCGGCTTTCTGGGCTTCCCGACCACTGGTCGTCTCGTTGTGTACCCGTGGACCGGCCGCCTGGTTTGTTACCCACAGACGGGTCGCTTTCGCCCGCGTATTATGACGCCGTAA, coding recombinant protein, culturing of obtained strain with induction of protein expression by addition of IPTG, lysing including processing cells with ultrasonic disintegrator to produce supernatant, supernatant purification with Q-Sepharose and SP-Sepharose, combining fractions, containing target product.

EFFECT: proposed method can be used during production and application of medicinal substances, based on mixture of biologically active peptides.

1 cl, 5 dwg, 2 tbl, 3 ex