FIELD: medicine.
SUBSTANCE: invention relates to a fields of medical and molecular genetics, as well as to gene therapy, and concerns a set of six Dyser’s substrates. Presented kit includes six Dyser’s substrates that form six siRNAs in human cells: 5'AAAAAGCAUCAGAAAGAACCUCCAUUU 3' – A1 (7); 5'AAAUGGAGGUUCUUUCUGAUGCUUUUU 3' – A1 (8); 5'AGACAUAGUUAUCUAUCAAUACAUGGA 3' – A2 (9); 5'UCCAUGUAUUGAUAGAUAACUAUGUCU 3' – A2 (10); 5'AGGAGUAGUGGAGUCUAUGAAUAAGGA 3' – A3 (11); 5'UCCUUAUUCAUAGACUCCACUACUCCU 3' – A3 (12); 5'GUGUGGACUAUAGUAGGUAUAGAAUAU 3' – A4 (13); 5'AUAUUCUAUACCUACUAUAGUCCACAC 3' – A4 (14); 5'ACCAGGACAGACAUGGUAUGGAACAGG 3' – A5 (15); 5'CCUGUUCCAUACCAUGUCUGUCCUGGU 3' – A5 (16); 5'GUGCGAGAGCGUCAGUAUUAAGUGGGG 3' – A6 (17); 5'CCCCACUUAAUACUGACGCUCUCGCAC 3' – A6 (18), which when injected into human cells are capable to infect corresponding conservative targets in HIV-1 mRNA (A1–A6): 5'AAAAAGCATCAGAAAGAACCTCCATTT 3' – A1 (1); 5'AGACATAGTTATCTATCAATACATGGA 3' – A2 (2); 5'AGGAGTAGTGGAGTCTATGAATAAGGA 3' – A3 (3); 5'GTGTGGACTATAGTAGGTATAGAATAT 3' – A4 (4); 5'ACCAGGACAGACATGGTATGGAACAGG 3' – A5 (5); 5'GTGCGAGAGCGTCAGTATTAAGTGGGG 3' – A6 (6), located in the domains of reverse transcriptase (targets A1 and A2) and integrases (target A3) of the pol gene, in the mRNA of the vpu gene (target A4), as well as mRNA of the env gene in its domain gp120 (target A5) and mRNA of the gag gene in the p17 domain (target A6), and cause suppression of virus production in human cells.
EFFECT: invention can be used in medicine and scientific research.
1 cl, 2 dwg, 4 tbl, 1 ex
