FIELD: biotechnology.
SUBSTANCE: invention relates to the field of biotechnology, in particular to the recombinant plasmid pSC-A-5EV. Plasmid pSC-A-5EV is intended for expression of cloned biosynthetic genes of Y. pestis Yersinia. This plasmid contains a PCR copy of four genes (uro1529–1532) of Y. pestis siderophore biosynthesis of 5.6 kb length. This PCR copy is obtained on the Y. pestis EV76 chromosomal DNA template using primers p1529 (CCAAGTTCCTGCATTAGACAGA) and p1532r (CGTTGCCGGATCATTACTGACCCTGAAT). Present invention also relates to a method for constructing plasmid pSC-A-5EV and to a recombinant strain of Y. pestis KM1986. This strain is a superproducer of the siderophore Yersinia of the plague pathogen and is a product of transformation with the plasmid pSC-A5EV strain Y. pestis, which does not synthesize the own Yersinia siderophore.
EFFECT: invention makes it possible to obtain pestis Yersinia siderophore in high yield.
3 cl, 3 dwg, 3 ex, 1 tbl
| Title | Year | Author | Number |
|---|---|---|---|
| METHOD FOR Yersinia pestis Yersinia pseudotuberculosis STRAIN IDENTIFICATION | 2010 |
|
RU2422535C1 |
| ANTIPLAGUE VACCINE | 1996 |
|
RU2197988C2 |
| PROTEIN CAUSEING CELL AUTOAGGLUTINATION PROPERTY OF PLAGUE MICROBES, AND METHOD FOR PRODUCING IT | 2011 |
|
RU2473558C1 |
| METHOD OF ISOLATION OF SECRETION INHIBITOR OF SIDEROPHORES SYNTHESISED BY PGMSTRAINS Y. pestis AND ISOLATED INHIBITOR | 2013 |
|
RU2549712C1 |
| METHOD OF DIFFERENTIATING TYPICAL AND ATYPICAL STRAINS Yersinia pestis OF MEDIEVAL BIOVAR BY PCR METHOD WITH HYBRIDISATION-FLUORESCENT RECORDING RESULTS | 2014 |
|
RU2550257C2 |
| METHOD OF IDENTIFICATION AND INTRAGENERIC DIFFERENTIATION OF STRAINS OF SPECIES YERSINIA PESTIS | 2009 |
|
RU2404251C1 |
| MUTANT PHOSPHORIBOSYL PYROPHOSPHATE SYNTHETASE, DNA CODING SAID SYNTHETASE, BACTERIUM CODING SAID DNA, METHOD OF PRODUCING PURINE NUCLEOSIDES AND METHOD OF PRODUCING PURINE NUCELOTIDES | 2008 |
|
RU2403286C2 |
| METHOD OF DIFFERENTIATING STRAINS OF YERSINIA PESTIS INTO TOXICALLY ACTIVE AND INACTIVE ONES | 2017 |
|
RU2663133C1 |
| DIFFERENTIATION METHOD OF BIOVARS AND GENOVARIATIONS OF Yersinia pestis STRAINS OF MAIN SUBSPECIES BY MEANS OF POLYMERASE CHAIN REACTION | 2014 |
|
RU2565554C2 |
| SET AND METHOD FOR ACCELERATED PLAGUE MICROBE IDENTIFICATION AND SIMULTANEOUS DIFFERENTIATION OF VIRULENT AND AVIRULENT STRAINS OF YPESTIS BY PLASMID PROFILING THEREOF | 2011 |
|
RU2473701C1 |
Authors
Dates
2018-10-25—Published
2017-09-01—Filed