METHOD FOR PREDICTION OF RISK OF RENAL CELL CARCINOMA Russian patent published in 2020 - IPC C12Q1/68 

FIELD: biotechnology.

SUBSTANCE: invention represents a diagnostic technique for predisposition to renal cell carcinoma based on PCR-RFLP, which consists in DNA extraction from pre-selected biological material of patients with PCR reaction, using primers GCAGGCCTCTCTGTCTGAAC (SEQ ID NO: 2) and GATGACATGTGGGTGGTTGA (SEQ ID NO: 2), as well as the restriction analysis of the obtained amplicon. Restriction enzyme Tsel is used for restriction of the amplicon. Restriction enzyme forms unique restriction fragments in the presence of mutations and normal (31 bp, 61 bp and 104 bp in norm; 92 bp and 104 bp in the presence of a mutation). If observing a mutation during the reaction, a person in the European population has predisposition to renal cell carcinoma.

EFFECT: invention enables detecting predispositions to renal cell carcinoma in a human from the European population for 4½–6 hours (depending on the selected DNA extraction method) without the need to sequencing DNA samples.

1 cl