FIELD: biotechnology; molecular biology.
SUBSTANCE: method for identifying the Mycobacterium tuberculosis (MTB) bacteria using the loop isothermal amplification method (LAMP) is proposed. In the amplification reaction of a region of the target gene sequence, a set of oligonucleotide primers with the following nucleotide composition is used (5'→3'): (A) primer 2341FIP TAGCTGCCGGTCCAGGTCTGGTGGTGCGGGCCACTGA, (B) primer 2341BIP CAACCCAGTCCGGTGGTGTGCTTCGTCGACCGTGAACC, (C) primer 2341F3 ACCGGACCCCTCGTGT, (D) primer 2341B3 GATAGACCTGATCGACGCTG, (E) primer 2341LF ACCCGTTGCCG TTGATC, (F) primer 2341LB GTGGCACCTGCAASTTCS.
EFFECT: invention makes it possible to quickly and with good sensitivity determine MTB in biological samples that may contain mycobacterial cells and which have undergone the procedure of isolation and purification of mycobacterial DNA.
3 cl, 4 dwg, 2 ex
