FIELD: biotechnology.
SUBSTANCE: invention relates to biotechnology, molecular genetic diagnostics, in particular, to a method for genotyping a polymorphic locus rs7951676 (G>T) of the C11orf58 gene in a human by real-time PCR using allele-specific fluorescent probes, providing for PCR using specially selected primers (forward 5'-TGTCAGGCTAAATCTCATTTGCT-3' and reverse 5'-CATTTTCTTTCCTAAAGGCCAGT-3') and probes with fluorophores (G-allele-specific fluorescent-labelled probe 5'-(FAM)CTCTCCATGAGATATACTTGA(RTQ1)-3' and T-allele-specific fluorescent-labelled probe 5'-(ROX)CTCTCCATGATATATACTTGA(BHQ2)-3') in an amplifier with fluorescence detection.
EFFECT: invention widens the range of methods for genotyping polymorphic variants of the C11orf58 gene, is characterized by simplicity, accuracy and low cost.
1 cl, 1 dwg
Authors
Dates
2024-05-27—Published
2023-12-25—Filed