FIELD: molecular biology, virology. SUBSTANCE: method is based on reverse transcription reaction of viral genome site in region of gene encoding leader sequence of virus membrane protein using primer comprising of 23 links with the following nucleotide sequence: GGGCATTCATAAGTGATAGTATC. The following double amplification is carried out using system of primers. For the first amplification oligonucleotides 2F, 22 links and 518R, 23 links with sequence of nucleotides GTAGTTCGCCTGTGTGAGCTGA and TCGGTAGCATTTACCGTTCATCAT are used and for the second amplification oligonucleotides 26 F, 22 links with nucleotides sequence AACTTAGTAGTGTTTGTGAGGA and 518 R, 23 links are used. Virus is detected by the presence of band of size 495 nucleotide pairs in analyzed sample after separation of part of reaction mixture in agarose gel. Method provides high sensitivity and specificity to West Nile fever virus that ensures to detect the presence of viral RNA in analyzed samples definitely. Invention can be used in diagnosis of West Nile fever virus. EFFECT: improved method of virus detection. 1 dwg, 6 ex
