METHOD FOR FORMATION OF DNA METHYLATION MARKER SYSTEMS Russian patent published in 2013 - IPC C12Q1/68 C12N15/10 

FIELD: medicine.

SUBSTANCE: method involves genome DNA recovery, hydrolysis by methyl-sensitive and non-methyl-sensitive isoschizomers of restriction endonucleases. The DNA hydrolysis products are ligated with universal adapters from oligonucleotides CCGGTCAGAGCTTTGCGAAT and ATTCGCAAAGCTCTGA. It is followed by a chain reaction with universal fluorescence-labelled primers ATTCGCAAAGCTCTGACCGGGN conjugated in 5'-terminal with the fluorescent dye FAM with further capillary electrophoresis which induces formation of the marker system in the form of electrophoretogram peaks. The electrophoretogram peaks are analysed with the use of the whole kit of the system markers in the form of complete representation.

EFFECT: invention provides higher reproducibility of the formed DNA methylation marker system, simplifying a procedure of characterising normal tissue methylotypes, reducing a time of screening cycle, providing high performance of the method.

3 dwg, 1 ex