FIELD: veterinary medicine.
SUBSTANCE: invention relates to veterinary virology, specifically to molecular diagnostics. There are developed oligonucleotide primers for detecting DNA of African swine fever virus: F3 p22 GTTTTACGGATACTGCTGC, B3 p22 CCTTACCATATTTAAGAACCGG, FIP p22 TGGGGGCTATGGGATTCACT-AAGAATTTGGAAAAACACGGC, BIP p22 TGTGTGAAAAATATTGTTCATGGGG-ACATAACATGTTCCCTCCTT, LoopB p22 CCGATGACTGTACAGGTTGGG. Disclosed also is a method for detecting DNA of African swine fever virus from biological material using modified PCR, specifically loop isothermal amplification (LAMP).
EFFECT: present invention enables fast and high-reliability detection of the presence of DNA of ASF virus by loop isothermal amplification when examining samples of a wide range of pathological and biological material in field conditions and laboratories.
2 cl, 4 tbl, 2 ex
Authors
Dates
2019-12-24—Published
2018-12-14—Filed