METHOD FOR DIAGNOSING HODGKIN LYMPHOMA Russian patent published in 2022 - IPC G01N33/574 G01N33/68 G01N33/52 

FIELD: biotechnology.

SUBSTANCE: invention relates to biotechnology and diagnostic medicine and can be used to diagnose Hodgkin lymphoma (HL). A total population of nanosized extracellular vesicles (nEV) is isolated from blood plasma using a two-phase polymer system. A complex of gold nanoparticles (AuNPs) 5 to 10 nm in size and DNA aptamers ACTGGGCGAAACAAGTCTATTGACTATGAG (CD30-Apt) taken in a ratio of 10 mcl/2.5 mcl is formed. The resulting complex is incubated with the total population of nEV taken in a volume of 1 mcl. 10 mcl of a substrate of tetramethylbenzidine (TMB) in a concentration of 100 pmol/ml is added. The resulting mixture of the nEV preparation with the three components of AuNPs, CD30-Apt, and TMB is incubated for 18 minutes at 37°C. The nEV fraction with the membrane including the protein marker CD30 (CD30 (+) nEV) is quantified by conducting a colour reaction of oxidation of TMB and recording the optical density of the mixture using spectrophotometric analysis at a 378 nm wavelength. The value of 1.8 to 2.2 of the optical density is taken as the norm. If the value is from 6 to 11, HL is diagnosed.

EFFECT: possibility of diagnosing HL using a new technology for quantifying CD30(+)nEV based on the effect of variation in the enzyme-mimetic properties of AuNPs as a result of surface adsorption of DNA thereon; method is safe and harmless for patients, and the procedure is inexpensive.

1 cl, 6 dwg, 2 ex