FIELD: biotechnology.
SUBSTANCE: invention relates to biotechnology, molecular genetic diagnostics, and can be used in medicine when determining hereditary predisposition to developing diseases associated with carriage of polymorphic variant rs17078346 (A>C). Disclosed is a method for genotyping a polymorphic locus rs17078346 (A>C) in a human by real-time PCR using allele-specific fluorescent probes, involving PCR using specially selected primers (forward 5′-TCCTTTCCCTTCCCTTCTTC-3′ and reverse 5′-TGGTGTGATGAGGAACCAAG-3′) and probes with fluorophores (A-allele-specific fluorescent-labelled probe 5′-(FAM)CATCTTTAAAAACTTCTAGATCTGCT(RTQ1)-3′, C-allele-specific fluorescent-labelled probe 5′-(ROX)CATCTTTAAAACCTTCTAGATCTGCT(BHQ2)-3′) in an amplifier with fluorescence detection.
EFFECT: invention widens the range of methods for genotyping polymorphic variants of the gene associated with a severe course of COVID-19, is characterized by simplicity and accuracy.
1 cl, 1 dwg
