FIELD: veterinary science.
SUBSTANCE: invention relates to veterinary virology and biotechnology, namely, to genetic engineering. There are offered synthetic oligonucleotide primers for identification of RNA atypical pestivirus of cattle and application method. Represented synthetic oligonucleotide primers have nucleotide sequences: SEQ ID NO: 1 - 5' tttgcagccgagcgtag 3', SEQ ID NO: 2 - 5' cctcctgcatactgtcacctt 3'. Disclosed method involves RNA recovery from embryonic sera samples and biological material, conducting reverse transcription and PCR with synthetic oligonucleotide primers, transfer of the amplification product on gel and evaluation the reaction. PCR is carried out in 1 round. In case of positive reaction enables synthesizing a fragment, corresponding to 320 p.n.
EFFECT: invention can be used in veterinary science for detection of possible contaminations of embryo serums, used for cultivation of cell cultures and production of biopreparations, atypical pestivirus of cattle, as well as for diagnosis of infectious diseases in farm animals, in particular infection caused by atypical pestivirus of cattle.
2 cl, 1 dwg, 3 tbl, 4 ex
