METHOD FOR LEUKOSIS DIAGNOSIS IN CATTLE Russian patent published in 2018 - IPC C12Q1/66 

FIELD: veterinary medicine.

SUBSTANCE: method for express diagnostics of cattle leukosis by real time polymerase chain reaction is described. The method includes application of a forward and reverse oligonucleotide primer, adding an oligonucleotide probe with a fluorescent label to the reaction mixture to detect a fragment of the cattle leukosis provirus gene, characterized by application of oligonucleotides of PF: 5'-GGCACCGGGTCTCGCAAGTATG-3', PR: 5'CGGTTAGGCTGGTCATGTGGCC-3' structure as promers, and of probe RT p 24AAACACTACGACTTGCAATCTTACAGGCCGAC labeled with fluorescent ROX dye at the 5'-end and with RTQ2 quencher at the 3'-end, as an oligonucleotide probe.

EFFECT: invention expands the arsenal of methods for diagnosis of cattle leukosis.

6 dwg, 8 tbl