FIELD: biotechnology.
SUBSTANCE: invention relates to biotechnology and can be used in the food industry in the identification of osmotolerant yeast Zygosaccharomyces rouxii. Method includes pre-enrichment of yeast, their precipitation by centrifugation, isolation of DNA with real-time PCR, and primers are used for amplification: ZygRux-f GACGTGAACTCTTAACGGAG and ZygRux-r GAGAGCAGAACCCTCCC, and also Taqman probe ZygRux-p FAM CGGAGGAGATTAAAAACAGCCGCGCA BHQ1, logarithmic increase in the level of fluorescence in the FAM channel indicates the presence of a strain of the yeast of the genus Zygosaccharomyces rouxii.
EFFECT: invention can be used in the food industry in identifying the osmotolerant yeast Zygosaccharomyces rouxii.
1 cl, 1 dwg, 1 ex
