FIELD: biotechnology; molecular genetic diagnostics.
SUBSTANCE: invention can be used in medicine to determine the hereditary predisposition to the development of diseases associated with carriage of rs8107914 (C>T) polymorphic variant of C19orf53 gene. The following is proposed: a method of genotyping rs8107914 (C>T) polymorphic locus of C19orf53 gene in humans by real-time PCR using allele-specific fluorescent probes, involving PCR using specially selected primers: forward 5'-CGCCTTTAGCAACCATGTG-3' and reverse 5'-CCAGCTTGACTCTGGTTGTG-3', and probes with fluorophores: C-allele-specific fluorescently labeled probe 5'-(FAM) CCGGGAAAGAGTCTTTTCTCC(RTQ1)-3' and T-allele-specific fluorescently labeled probe 5'-(ROX)CCGGGAAAGAGTTTTTTCTCC(BHQ2)-3' in amplifier with fluorescence detection.
EFFECT: expanding the arsenal of methods of genotyping polymorphic variants of C19orf53 gene, obtaining a simple and accurate method.
1 cl, 1 dwg
Authors
Dates
2023-12-05—Published
2023-10-21—Filed