FIELD: biotechnology.
SUBSTANCE: invention relates to biotechnology, molecular genetic diagnostics, and can be used in medicine in determining hereditary predisposition to developing diseases associated with carriage of polymorphic variant rs862832 (C>T) of the HSPA12B gene. Disclosed is a method for genotyping a polymorphic variant rs862832 (C>T) of the HSPA12B gene in a human by real-time PCR using allele-specific fluorescent probes, involving PCR using specially selected primers (forward 5′-TGTGGTGGTGGCAGCTAC-3′ and reverse 5′-CAGCATTTCAGGGCAGGAC-3′) and probes with fluorophores (C-allele-specific fluorescent-labelled probe 5′-(FAM)CAGGGCTACTCCACTCCCTCC(RTQ1)-3′ and T-allele-specific fluorescent-labelled probe 5′-(ROX)CAGGGCTACTCTACTCCCTCC(BHQ2)-3′) in an amplifier with fluorescence detection.
EFFECT: invention widens the range of methods for genotyping polymorphic variants of the HSPA12B gene, is characterized by simplicity, accuracy and low cost.
1 cl, 1 dwg
