METHOD FOR DETECTING JUNIN VIRUS RNA BY REAL-TIME RT-PCR Russian patent published in 2024 - IPC C12Q1/68 C12Q1/686 

FIELD: biotechnology.

SUBSTANCE: described is a method for detecting Junin virus RNA by real-time RT-PCR, involving extraction of RNA from biological samples, followed by a two-step RT-PCR reaction for the target RNA fragments of the viral genome using a set of oligonucleotide primers and a corresponding fluorescent-labelled probe, complementary to a portion of the L gene coding the RNA-dependent RNA polymerase of the Junin virus, sequence is used as a forward primer tgggctgataaacttgtttaatttag, as a reverse primer – tgatgtgatacctgtcacttatac, and as a probe – a sequence tcatggaagcacaccatttccagcag, in which a fluorescent label R6G is located at 5'-end, and a non-fluorescent quencher BHQ1 is located at 3'-end.

EFFECT: method is intended for monitoring and diagnosing Junin virus in healthy people, patients and individuals with suspected haemorrhagic fever caused by Junin virus.

1 cl, 1 dwg, 3 tbl, 1 ex