FIELD: biotechnology.
SUBSTANCE: disclosed is a method of identifying genes coding AHL-lactonase (aiiA) and laccase (cotA) in bacteria of the genus Bacillus. Method consists in extraction of nucleic acid by any method which enables to obtain DNA for a reaction mixture in an amount of not less than 100 ng, followed by a polymerase chain reaction using a set of original primers: cotA (Bacillus subtilis subsp. subtilis str. 168): forward TCGGCACAACTGAAATATGGTC and reverse GTCTTTCCAGCCCTTTTCACTT; cotA (Bacillus pumilus strain WH4): forward TCCTGCCTGTCGATCATACC and reverse TGCTTGCTGGTGATTAGGGT, aiiA (Bacillus cereus B4264): forward and reverse TGTGCAGCGAACGGAATATGTGAATAGCGACTGATGGCCT, aiiA (Bacillus thuringiensis Bt407): forward TGAGCCGGACGACCTTTTAT and reverse GATGGCCTGGAGAATGACCT. PCR results are assessed by electrophoretic separation of amplification products based on the presence of target 1,000 bp fragment.
EFFECT: invention enables identification of genes coding AHL-lactonase (aiiA) and laccase (cotA) in bacteria of the genus Bacillus, isolated from a fodder additive, or obtained from pure bacterial cultures.
1 cl, 12 dwg, 3 tbl, 1 ex
