METHOD FOR GENE IDENTIFICATION OF BOVINE LEUKEMIA VIRUS Russian patent published in 2022 - IPC C12Q1/68 C12N15/00 

FIELD: biotechnology.

SUBSTANCE: invention relates to biotechnology, namely, to molecular genetic research methods in laboratory diagnostics and monitoring of the causative agent of bovine leukemia. Proposed is a method for gene identification of Bovine leukemia virus (abbr. BLV) with a combined technique of polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). In the method, a strategy of PCR-RFLP genotyping of BLV is used. The strategy is based on phylogenetic analysis of the env gene of the causative agent. Specific "external" TCTGTGCCAAGTCTCCCAGATA and AACAACAACCTCTGGGAAGGGT and "internal" CCCACAAGGGCGGCGCCGGTT and GCGAGGCCGGGTCCAGCTGG primers, and corresponding restriction endonucleases - PvuII-RFLP, SspI-RFLP, AsuHPI-RFLP, HaeIII-RFLP, and BstX21-RFLP are used in nested PCR. The RFLP protocol consists of 5 consecutive steps initiating the development of a fragment of the env gene of the causative agent at the final stage of the reaction. The genotype is determined based on the analysis of alignment and restriction mapping of the DNA sequences of the env gene locus of reference isolates of known genotypes of BLV, followed by in silico modelling of restrictograms for 5 restriction endonucleases: PvuII, SspI, HphI (an AsuHPI isoschizomer), HaeIII, BstYI (a BstX2I isoschizomer).

EFFECT: invention ensures identification of 11 genotypes of a viral pathogen.

1 cl, 2 tbl, 2 dwg